Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_4066

SGN-M23087

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59418)
Chromosome
4
Position
63.65 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AATAGATGCAATCAAAGGAGAAGCAGAAGAGATAAAAAGCTTGGGAGACA
  
3' flanking region
AGCAATTTATGTGGGATGTAATGCATCAATTGCCATAGACTGTTCCAAGT
SNP nucleotide
AG
SNPdb format
AATAGATGCAATCAAAGGAGAAGCAGAAGAGATAAAAAGCTTGGGAGACA[A/G]
AGCAATTTATGTGGGATGTAATGCATCAATTGCCATAGACTGTTCCAAGT
  
Genomic location of solcap_snp_sl_4066  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23087 marker 23087
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)