SGN Marker TG283

SGN-M231

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG283 image not available
Forward sequence
CAAAAAGAAAATTGACATATAATTAAAATTAGAAAATATTTTTGAGTTATTTCTGACACATCAAAGGGATTTCCCTTTTCTTTTTTTTTT
TTAAATCTAACAGGTAGAAAAAAGGGCAAATCTGAACCATTCCTCAAAAGGAGGCATTTCTGAACCATTCCAATTGTGTCAAGAGCATTT
TTTACCCAATAGGTTGAGTTAAGAGAAAATTAAATCCAATAGGTAGAAGGGCATCTCTGAAGTATTTTTTAATATGTTAAAAGGGCATTT
TAGAACCTTTTCAGAATAAAATAAGATGGCTGTTGGAAGCTCGGAATCCAGCTCGCATTGCTTTCCGCAAGAGCAAAAGCTGTTCAGTAA
CTAGACCAGTGACCAAACGAGACTTCGTGTACAAAAAAAAACAAACTGTGCCCCCACACCTTCCACGAGGGTCCGCCTCTACGAAGAATA
AAAGTTTTGATAACCTTAGACATGATATACAATCAAACACGCCGCTGCAAAATT
Reverse sequence
TATAGGGAGACAAGCTTGCATGCCTGCAGCTGTGAGACACACAGGGCAATACAAAAACAAATGATTGATGGTTTCTGGATAAATTCCATA
AAGGTAGATTTTCCTGTGTCAAGTTGAGTTTTTGTCGCTAGCCACACATGATATGCAACTTCCACTGGTGCTTTAGATCTCCATATGCTT
TTCCAAGGCAACGAGTTATCATACTGTGAATCGGCAACTAAGTTCATAATATGAGTTAGTAGTATTGGATCTCCGTATGTTTGTCCACAC
ATTATGGTGTATCTCTTGATTCTGTCATCCCCCCACTTTAATTTTTTCTTTTAAAGATGATGTTCGGCCAAAGTCCTGTCATAATATCCA
ATTCTCTTGGTTCCTTGTGTTTCTCCTTTTTGGTTTGGTGGTGACACTTGAGATTACAAAACAAGTACTGCTGTTGGTATCCACCACATT
TATGGCACTTGTCTTTTGGAGTTTGAACTATGAGTTGATTTAAATGGAGTGACATGGATTCGTACAGTCAATTCCAGCTTAGATTGGGAT
TGAGGCATTA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1498561.1e-2050 (9.9% of RFLP seq)+
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53251)
Chromosome
12
Position
44.88 cM
Confidence
uncalculated
Protocol
unknown

MQTL_2_Late_blight_12 MQTL_1_Late_blight_12
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42432)
Chromosome
5
Position
62.20 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39977)
Chromosome
12
Position
54.80 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8687)
Chromosome
12
Position
79.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 8689)
Chromosome
5
Position
62.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8688)
Chromosome
12
Position
42.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8686)
Chromosome
12
Position
37.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG283 was used as an overgo probe on plate 7 [well A3]

Plausible BAC Matches:   P202O12,   P233G20,   P093H06,   P198J17,   P322C23,   P288A04,   P148A21,   P256L23,   P251A18,   P120I01,   P169P18,   P282K08,   P319A17,   P331L16,   P005C19,   P309I22,   P156N23,   P255E04,   P331C15,   P043K11,   P152A18,   P315P01,   P270B18,   P119J03,   P077I15,   P192H18,   P214M13

 Overgo Sequences

A sequence
GATGGCTGTTGGAAGCTCGGAATC
B sequence
AAAGCAATGCGAGCTGGATTCCGA
AB sequence
GATGGCTGTTGGAAGCTCGGAATCCAGCTC
Marker sequence
CAAAAAGAAAATTGACATATAATTAAAATTAGAAAATATTTTTGAGTTAT
TTCTGACACATCAAAGGGATTTCCCTTTTCTTTTTTTTTTTTAAATCTAA
CAGGTAGAAAAAAGGGCAAATCTGAACCATTCCTCAAAAGGAGGCATTTC
TGAACCATTCCAATTGTGTCAAGAGCATTTTTTACCCAATAGGTTGAGTT
AAGAGAAAATTAAATCCAATAGGTAGAAGGGCATCTCTGAAGTATTTTTT
AATATGTTAAAAGGGCATTTTAGAACCTTTTCAGAATAAAATAAGATGGC
TGTTGGAAGCTCGGAATCCAGCTCGCATTGCTTTCCGCAAGAGCAAAAGC
TGTTCAGTAACTAGACCAGTGACCAAACGAGACTTCGTGTACAAAAAAAA
ACAAACTGTGCCCCCACACCTTCCACGAGGGTCCGCCTCTACGAAGAATA
AAAGTTTTGATAACCTTAGACATGATATACAATCAAACACGCCGCTGCAA
AATT
Genomic location of TG283  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D231 marker 231
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)