SGN Marker solcap_snp_sl_40727

SGN-M23103

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72758)
Chromosome
6
Position
29.72 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68801)
Chromosome
6
Position
35.49 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65173)
Chromosome
6
Position
46.81 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59434)
Chromosome
6
Position
36.32 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTGTACTGTGCTGGAATTTTGTATGGTGCACGTCTGGTGGAGCTTGCTT
  
3' flanking region
AAACATTGATATGCTAATAATATAACCGATAGACCTTGATTTATACTTGG
SNP nucleotide
AT
SNPdb format
TTTGTACTGTGCTGGAATTTTGTATGGTGCACGTCTGGTGGAGCTTGCTT[A/T]
AAACATTGATATGCTAATAATATAACCGATAGACCTTGATTTATACTTGG
  
Genomic location of solcap_snp_sl_40727  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23103 marker 23103
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)