SGN Marker solcap_snp_sl_40910

SGN-M23136

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72780)
Chromosome
12
Position
12.19 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68812)
Chromosome
12
Position
22.27 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65184)
Chromosome
12
Position
23.75 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59467)
Chromosome
12
Position
1.86 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTGATAAGTTGTTTTAATTTAACCTGGTTAAGATTTCTGTTGTATATATC
  
3' flanking region
ATCCTGATCCTGAATTAATTGCTCATTTATCGCTGAGCGATGGGTTCAAC
SNP nucleotide
AG
SNPdb format
TTGATAAGTTGTTTTAATTTAACCTGGTTAAGATTTCTGTTGTATATATC[A/G]
ATCCTGATCCTGAATTAATTGCTCATTTATCGCTGAGCGATGGGTTCAAC
  
Genomic location of solcap_snp_sl_40910  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23136 marker 23136
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)