SGN Marker solcap_snp_sl_40952

SGN-M23144

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68817)
Chromosome
12
Position
24.80 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65189)
Chromosome
12
Position
25.10 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59475)
Chromosome
12
Position
1.97 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCCTCTGAAGTGATTGATCCCAACACTGGTTTACTTTATACGAACATGTT
  
3' flanking region
GATGCTCAGCTTGATGCTATTAACTATGCTTTAATGGCTCTAAATTTCAA
SNP nucleotide
TC
SNPdb format
TCCTCTGAAGTGATTGATCCCAACACTGGTTTACTTTATACGAACATGTT[T/C]
GATGCTCAGCTTGATGCTATTAACTATGCTTTAATGGCTCTAAATTTCAA
  
Genomic location of solcap_snp_sl_40952  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23144 marker 23144
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)