SGN Marker solcap_snp_sl_41031

SGN-M23153

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72789)
Chromosome
12
Position
18.81 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68820)
Chromosome
12
Position
27.02 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65192)
Chromosome
12
Position
28.51 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59484)
Chromosome
12
Position
2.33 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCACCGGAGGTCTTGACGAAACTGTGAGGTTATGGGACCCGAGTAACTTC
  
3' flanking region
CTTGTGTTCAAACTTTCACCGGTCATTGTCTCGGCGTTGTATCTGTTGCT
SNP nucleotide
AG
SNPdb format
TCACCGGAGGTCTTGACGAAACTGTGAGGTTATGGGACCCGAGTAACTTC[A/G]
CTTGTGTTCAAACTTTCACCGGTCATTGTCTCGGCGTTGTATCTGTTGCT
  
Genomic location of solcap_snp_sl_41031  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23153 marker 23153
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)