SGN Marker solcap_snp_sl_41194

SGN-M23173

Synonyms  
SGN-U564534_snp936
SGN-U564534_snp936_solcap_snp_sl_41194
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70378)
Chromosome
12
Position
24.06 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66910)
Chromosome
12
Position
36.40 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63392)
Chromosome
12
Position
35.39 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59504)
Chromosome
12
Position
3.10 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCCAGCTCAGTGATATTCGTGTCATTTGGATCAACGACTACATTATCACA
  
3' flanking region
GAGCAAATCAATGAGATTGCTCTGGGTTTAGAACAGAGTAATCACAGATT
SNP nucleotide
AG
SNPdb format
GCCAGCTCAGTGATATTCGTGTCATTTGGATCAACGACTACATTATCACA[A/G]
GAGCAAATCAATGAGATTGCTCTGGGTTTAGAACAGAGTAATCACAGATT
  
Genomic location of solcap_snp_sl_41194  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23173 marker 23173
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)