SGN Marker solcap_snp_sl_41224

SGN-M23179

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68827)
Chromosome
12
Position
38.92 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65199)
Chromosome
12
Position
36.73 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59510)
Chromosome
12
Position
3.32 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGGATGACATTTTACAAACACACTCATGCTCTGGACAGGACATGGCATCT
  
3' flanking region
CTCGGGTTGGGGTATGACTCGGGTGTCACACGAGCACAAATCGAGCAGGC
SNP nucleotide
AT
SNPdb format
TGGATGACATTTTACAAACACACTCATGCTCTGGACAGGACATGGCATCT[A/T]
CTCGGGTTGGGGTATGACTCGGGTGTCACACGAGCACAAATCGAGCAGGC
  
Genomic location of solcap_snp_sl_41224  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23179 marker 23179
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)