Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker T1850

SGN-M2318
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 7.01
Tomato EST read: TRZCJ56TH
Arabidopsis best BAC match: AB025622.1
Arabidopsis position: 5.2090000
Arabidopsis identities: 0.903
Best GenBank protein hit: CAA76178.1
Evalue: 8e-105
Identities: 0.911
Description: putative cyclic nucleotide-regulated ion channel [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39788)
Chromosome
3
Position
44.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1850 was used as an overgo probe on plate 1 [well G9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGAGGGTGAAAAGACGAGATGCAG
B sequence
TGAGACATCCACTGCTCTGCATCT
AB sequence
TGAGGGTGAAAAGACGAGATGCAGAGCAGT
Marker sequence
GCTTGTGGTGTGACAGACGTATCTGCAGTCTACAACACTCAGACTAGAAG
AGATGAGGGTGAAAAGACGAGATGCAGAGCAGTGGATGTCTCACCGCTTA
CTCCCTGAGCACCTCCGGGAGAGGATCAGGCGCTATGAGCAATACAAGTG
GCAGGAAACTAGGGGTGTTGATGAAGAGACTCTGATCCTCAACCTGCCTA
AAGATCTTAGAAGAGATATTAAGCGTCATCTTTGTTTGGCTTTGCTAATG
AGGGTTCCAATGTTTGAAAAAATGGATGAGCAACTCCTGGATGCACTATG
TGACCGTCTCAGGCCTGTCCTCTACACAGAGAACAGCTTCATTGTGCGTG
AAGGTGATCCGGTTGATGAGATGCTTTTTATAATGCGGGGCAAACTATTG
ACCGTAACGACTAATGGAGGGAGGACAGGGTTTTTTAACTCTGATTATCT
AAAAGCTGGTGATTTTTGTGGAGAAGAGCTTCTTACTTGGGCTCTTGATC
CTCATCCATCAAATAACCTCCCAATCTCAACCCGAACTGTCCAAGCACTC
TCAGAAGTTGAAGCATTTGCTCTAGTGGCGGATGATTTGAAATTTGTAGC
CTCTCAGTTCCGGAGACTTCATAGC
Genomic location of T1850  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2318 marker 2318
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)