SGN Marker solcap_snp_sl_41240

SGN-M23185

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72805)
Chromosome
12
Position
27.08 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68829)
Chromosome
12
Position
39.55 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65201)
Chromosome
12
Position
42.24 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59516)
Chromosome
12
Position
3.48 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTTCAAATTTCTCTTTATGGGTATTTGAGAATTCACTTTCTATTTGTAA
  
3' flanking region
GATCTGATCTTTTCACTGCAATCAGTCTTGGAAATGTCCAAATTCTCCAT
SNP nucleotide
AC
SNPdb format
TTTTCAAATTTCTCTTTATGGGTATTTGAGAATTCACTTTCTATTTGTAA[A/C]
GATCTGATCTTTTCACTGCAATCAGTCTTGGAAATGTCCAAATTCTCCAT
  
Genomic location of solcap_snp_sl_41240  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23185 marker 23185
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)