SGN Marker solcap_snp_sl_41302

SGN-M23195

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72810)
Chromosome
1
Position
40.84 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68832)
Chromosome
1
Position
30.90 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65204)
Chromosome
1
Position
43.00 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59526)
Chromosome
1
Position
11.93 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATTGTTTCACGGCATGTTGGAAAAGAAAAAAAAACACTACTTTCATGCTT
  
3' flanking region
TGTTAAGGCAAACAGTCGACAGATCATTAACTTCCATGAAATAAAAATAA
SNP nucleotide
TG
SNPdb format
ATTGTTTCACGGCATGTTGGAAAAGAAAAAAAAACACTACTTTCATGCTT[T/G]
TGTTAAGGCAAACAGTCGACAGATCATTAACTTCCATGAAATAAAAATAA
  
Genomic location of solcap_snp_sl_41302  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23195 marker 23195
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)