SGN Marker solcap_snp_sl_41523

SGN-M23237

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68851)
Chromosome
4
Position
44.31 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65223)
Chromosome
4
Position
42.29 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59568)
Chromosome
4
Position
4.64 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTCCAGTAAAATTGTTGTATCCAAGATCCAATGTTATCAGAGATGATAT
  
3' flanking region
TTGAAAAGCGAATCTTCAAGTTCACCGCCCAATTGATTTTTGTCTAGATG
SNP nucleotide
AG
SNPdb format
TTTCCAGTAAAATTGTTGTATCCAAGATCCAATGTTATCAGAGATGATAT[A/G]
TTGAAAAGCGAATCTTCAAGTTCACCGCCCAATTGATTTTTGTCTAGATG
  
Genomic location of solcap_snp_sl_41523  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23237 marker 23237
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)