SGN Marker solcap_snp_sl_41575

SGN-M23239

Synonyms  
CL017744-0091
CL017744-0091_solcap_snp_sl_41575
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59570)
Chromosome
4
Position
4.94 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCGTACATTTTCCCAAGCTCGCCGGACTTCTTGATATCACCGCCGGTGTA
  
3' flanking region
GGCACTGCGCGTGAACCCATTGTAGGCTGACGTTCCTTGAGCTGTTCGGG
SNP nucleotide
TC
SNPdb format
CCGTACATTTTCCCAAGCTCGCCGGACTTCTTGATATCACCGCCGGTGTA[T/C]
GGCACTGCGCGTGAACCCATTGTAGGCTGACGTTCCTTGAGCTGTTCGGG
  
Genomic location of solcap_snp_sl_41575  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23239 marker 23239
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)