Notice: Due to a server issue, SGN was unavailable earlier today. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_41741

SGN-M23261

Synonyms  
CL017213-0398
CL017213-0398_solcap_snp_sl_41741
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59592)
Chromosome
4
Position
6.91 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTCTAAAGTCTCTAATGGTCTTATCATTTCCCATCAATGAAGAATTAAC
  
3' flanking region
GTTAGCTCATCATGGATTCTTAAACCAACTATGGCTTCAGGGAAGCAATG
SNP nucleotide
TC
SNPdb format
TCTCTAAAGTCTCTAATGGTCTTATCATTTCCCATCAATGAAGAATTAAC[T/C]
GTTAGCTCATCATGGATTCTTAAACCAACTATGGCTTCAGGGAAGCAATG
  
Genomic location of solcap_snp_sl_41741  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23261 marker 23261
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)