Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_41764

SGN-M23265

Synonyms  
SGN-U574577_snp856
SGN-U574577_snp856_solcap_snp_sl_41764
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70414)
Chromosome
4
Position
38.52 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66944)
Chromosome
4
Position
49.98 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63424)
Chromosome
4
Position
56.09 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59596)
Chromosome
4
Position
7.19 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAATTCATCCACCTCCATAGGATTAGACAATTGATGTATCTTTCTCCTGG
  
3' flanking region
CTTTGCTTTGACTTTCTTTGCATATTTGCCAGCCTTCTGTTTTTTCTCTA
SNP nucleotide
TC
SNPdb format
AAATTCATCCACCTCCATAGGATTAGACAATTGATGTATCTTTCTCCTGG[T/C]
CTTTGCTTTGACTTTCTTTGCATATTTGCCAGCCTTCTGTTTTTTCTCTA
  
Genomic location of solcap_snp_sl_41764  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23265 marker 23265
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)