SGN Marker solcap_snp_sl_42743

SGN-M23320

Synonyms  
SGN-U565734_snp230
SGN-U565734_snp230_solcap_snp_sl_42743
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70385)
Chromosome
12
Position
53.46 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66916)
Chromosome
12
Position
62.47 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63398)
Chromosome
12
Position
85.49 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59651)
Chromosome
12
Position
48.33 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGTCGCAAGAAAGCGTGCAGAGGATATAGCTGCAGGGGCAGTGCAAATGA
  
3' flanking region
TGGTCGTGAACTTTTCTTGCACGAGCCATGGGTCTTCGATAACTCCCTTT
SNP nucleotide
AC
SNPdb format
AGTCGCAAGAAAGCGTGCAGAGGATATAGCTGCAGGGGCAGTGCAAATGA[A/C]
TGGTCGTGAACTTTTCTTGCACGAGCCATGGGTCTTCGATAACTCCCTTT
  
Genomic location of solcap_snp_sl_42743  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23320 marker 23320
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)