SGN Marker solcap_snp_sl_42850

SGN-M23330

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72873)
Chromosome
4
Position
42.63 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68886)
Chromosome
4
Position
54.72 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65260)
Chromosome
4
Position
60.87 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59661)
Chromosome
4
Position
52.42 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATTGGTTTGTCTGAGAGCGAAGAGGAAGTTGTTGAAGGAGGAGATAACGA
  
3' flanking region
TTTGTGTGAGTTAACTCCGTAGAATTATTCTTCCGATTTAACTCATCACT
SNP nucleotide
TG
SNPdb format
ATTGGTTTGTCTGAGAGCGAAGAGGAAGTTGTTGAAGGAGGAGATAACGA[T/G]
TTTGTGTGAGTTAACTCCGTAGAATTATTCTTCCGATTTAACTCATCACT
  
Genomic location of solcap_snp_sl_42850  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23330 marker 23330
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)