Notice: Due to a server issue, SGN was unavailable earlier today. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_42867

SGN-M23331

Synonyms  
SGN-U327596_C2_At1g05055_snp79
SGN-U327596_C2_At1g05055_snp79_solcap_snp_sl_42867
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70365)
Chromosome
4
Position
42.63 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66899)
Chromosome
4
Position
54.09 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63383)
Chromosome
4
Position
60.87 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59662)
Chromosome
4
Position
52.22 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CGAGAAGCATGGGAAAGAACTTATGCAGATGAAAGATCATGGGAGTCTTT
  
3' flanking region
CAAGAGGATGAATCAGGACTCCTTCGTCCAATTGACAACAAAACTCTATC
SNP nucleotide
AG
SNPdb format
CGAGAAGCATGGGAAAGAACTTATGCAGATGAAAGATCATGGGAGTCTTT[A/G]
CAAGAGGATGAATCAGGACTCCTTCGTCCAATTGACAACAAAACTCTATC
  
Genomic location of solcap_snp_sl_42867  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23331 marker 23331
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)