SGN Marker solcap_snp_sl_42882

SGN-M23334

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59665)
Chromosome
4
Position
51.80 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTTCACATGAATCAACTCCTTTTATCAACAAGAAGCAAATTTTCCAAATG
  
3' flanking region
GTGTTGGAATTTTGGCTGCTTCAATAGTGGCTTCAGCACCTTTAGATGCT
SNP nucleotide
AG
SNPdb format
CTTCACATGAATCAACTCCTTTTATCAACAAGAAGCAAATTTTCCAAATG[A/G]
GTGTTGGAATTTTGGCTGCTTCAATAGTGGCTTCAGCACCTTTAGATGCT
  
Genomic location of solcap_snp_sl_42882  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23334 marker 23334
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)