Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_42936

SGN-M23343

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72880)
Chromosome
4
Position
40.99 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68891)
Chromosome
4
Position
53.14 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65265)
Chromosome
4
Position
58.14 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59674)
Chromosome
4
Position
51.03 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATAATTTACATGTAAACAGAAACATAATCATCCTTAAGCTCGATACTTCA
  
3' flanking region
ACTCGTCTTCTACTAGTCAAAATTCCTTGACAGGTCTTCATCAAAACAGT
SNP nucleotide
TG
SNPdb format
ATAATTTACATGTAAACAGAAACATAATCATCCTTAAGCTCGATACTTCA[T/G]
ACTCGTCTTCTACTAGTCAAAATTCCTTGACAGGTCTTCATCAAAACAGT
  
Genomic location of solcap_snp_sl_42936  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23343 marker 23343
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)