SGN Marker solcap_snp_sl_42948

SGN-M23347

Synonyms  
SGN-U563966_snp493
SGN-U563966_snp493_solcap_snp_sl_42948
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59678)
Chromosome
12
Position
30.15 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CAATGCCGTTGTAGAACTGTTGCTGAAATGCTAGGCCAATATAAATCAAA
  
3' flanking region
GACCGGACTGCTCCCTGCAAGTTACCATATGCTGATGAATCCTTATAGAA
SNP nucleotide
AC
SNPdb format
CAATGCCGTTGTAGAACTGTTGCTGAAATGCTAGGCCAATATAAATCAAA[A/C]
GACCGGACTGCTCCCTGCAAGTTACCATATGCTGATGAATCCTTATAGAA
  
Genomic location of solcap_snp_sl_42948  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23347 marker 23347
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)