SGN Marker solcap_snp_sl_43712

SGN-M23403

Synonyms  
SGN-U585738_snp404
SGN-U585738_snp404_solcap_snp_sl_43712
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70479)
Chromosome
1
Position
86.81 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59734)
Chromosome
1
Position
79.15 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCAATCCGAGTTCTCTGGCTAGTTGAAGCTTCTTTCTTGGTTCAAGTTTG
  
3' flanking region
TCTCTGTTTCAAACATGGTTTCTAATGATTTAATCTGTTCATCGCTGAAC
SNP nucleotide
CG
SNPdb format
GCAATCCGAGTTCTCTGGCTAGTTGAAGCTTCTTTCTTGGTTCAAGTTTG[C/G]
TCTCTGTTTCAAACATGGTTTCTAATGATTTAATCTGTTCATCGCTGAAC
  
Genomic location of solcap_snp_sl_43712  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23403 marker 23403
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)