SGN Marker solcap_snp_sl_44009

SGN-M23422

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72928)
Chromosome
1
Position
93.42 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68924)
Chromosome
1
Position
84.30 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65292)
Chromosome
1
Position
132.51 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59753)
Chromosome
1
Position
80.73 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCACCTTGCTAAATATTGAGGCAGTGTCGTCGGGTAGAACTGATAGATTT
  
3' flanking region
TTGCACTTTCTAGAGTGGAGGCTGACGTCTTCTGTTTTACTGCTGTTTCT
SNP nucleotide
AC
SNPdb format
GCACCTTGCTAAATATTGAGGCAGTGTCGTCGGGTAGAACTGATAGATTT[A/C]
TTGCACTTTCTAGAGTGGAGGCTGACGTCTTCTGTTTTACTGCTGTTTCT
  
Genomic location of solcap_snp_sl_44009  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23422 marker 23422
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)