SGN Marker solcap_snp_sl_44482

SGN-M23444

Synonyms  
SGN-U571854_snp167
SGN-U571854_snp167_solcap_snp_sl_44482
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70404)
Chromosome
1
Position
100.56 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66935)
Chromosome
1
Position
90.95 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63417)
Chromosome
1
Position
147.19 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59775)
Chromosome
1
Position
82.59 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AATTTTGGATCTCTCTGTTACTTGATTTCTTGCTAACAAACGGTCACGTA
  
3' flanking region
ATCTTTAGTGCTTCTTATAAGAGCAAAAAACTTGTCAATTTTCTCATCTT
SNP nucleotide
AT
SNPdb format
AATTTTGGATCTCTCTGTTACTTGATTTCTTGCTAACAAACGGTCACGTA[A/T]
ATCTTTAGTGCTTCTTATAAGAGCAAAAAACTTGTCAATTTTCTCATCTT
  
Genomic location of solcap_snp_sl_44482  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23444 marker 23444
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)