SGN Marker solcap_snp_sl_44831

SGN-M23481

Synonyms  
SL1_00sc6004_1744112
SL1_00sc6004_1744112_solcap_snp_sl_44831
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70577)
Chromosome
11
Position
82.51 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67071)
Chromosome
11
Position
85.72 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63537)
Chromosome
11
Position
99.99 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59812)
Chromosome
11
Position
51.93 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TACTTCACCCAGTTTACTCGAGTACTGGAGCTCCCGAGCTCAACACAGCA
  
3' flanking region
CTTAAGCTTCTCTAACCGTTGAGTCATTCATGGAGCACGAGTATAATAAC
SNP nucleotide
AG
SNPdb format
TACTTCACCCAGTTTACTCGAGTACTGGAGCTCCCGAGCTCAACACAGCA[A/G]
CTTAAGCTTCTCTAACCGTTGAGTCATTCATGGAGCACGAGTATAATAAC
  
Genomic location of solcap_snp_sl_44831  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23481 marker 23481
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)