SGN Marker solcap_snp_sl_44852

SGN-M23488

Synonyms  
SL1_00sc6004_1855106
SL1_00sc6004_1855106_solcap_snp_sl_44852
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67072)
Chromosome
11
Position
86.35 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63538)
Chromosome
11
Position
103.37 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59819)
Chromosome
11
Position
52.04 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACCAATTGCTGATCATATTGGAGTCCGTGGTTGTACAACTTCTAGCAGTG
  
3' flanking region
CGCTAGGAATGATTTTGCGAGTACCATGGAAGCTCCTGGGGAAGGTTTTT
SNP nucleotide
TC
SNPdb format
ACCAATTGCTGATCATATTGGAGTCCGTGGTTGTACAACTTCTAGCAGTG[T/C]
CGCTAGGAATGATTTTGCGAGTACCATGGAAGCTCCTGGGGAAGGTTTTT
  
Genomic location of solcap_snp_sl_44852  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23488 marker 23488
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)