SGN Marker solcap_snp_sl_44880

SGN-M23497

Synonyms  
SL1_00sc6004_2044251
SL1_00sc6004_2044251_solcap_snp_sl_44880
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70588)
Chromosome
11
Position
84.44 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59828)
Chromosome
11
Position
52.23 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AACCCTTTATAAGAATAGAAACATCGGCGCTCTTTCCTTTCACATCCGGA
  
3' flanking region
TGAGGAGAATGTTGGGACCGACCTGTCTAGGCCCTAAAGCCCAGATCCTT
SNP nucleotide
AG
SNPdb format
AACCCTTTATAAGAATAGAAACATCGGCGCTCTTTCCTTTCACATCCGGA[A/G]
TGAGGAGAATGTTGGGACCGACCTGTCTAGGCCCTAAAGCCCAGATCCTT
  
Genomic location of solcap_snp_sl_44880  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23497 marker 23497
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)