SGN Marker solcap_snp_sl_44897

SGN-M23499

Synonyms  
SL1_00sc6004_2094360
SL1_00sc6004_2094360_solcap_snp_sl_44897
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70590)
Chromosome
11
Position
85.27 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63545)
Chromosome
11
Position
102.01 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59830)
Chromosome
11
Position
52.28 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGTACGCAGAAGCCTTTGAAGGAGAAGTCCAAATTAAACGAAACTGATAC
  
3' flanking region
AAGTCTACAGCAACTGTTTCACAACAGGCTGCTGATTAGTTTTTAGGTAC
SNP nucleotide
TC
SNPdb format
AGTACGCAGAAGCCTTTGAAGGAGAAGTCCAAATTAAACGAAACTGATAC[T/C]
AAGTCTACAGCAACTGTTTCACAACAGGCTGCTGATTAGTTTTTAGGTAC
  
Genomic location of solcap_snp_sl_44897  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23499 marker 23499
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)