SGN Marker solcap_snp_sl_44911

SGN-M23501

Synonyms  
SL1_00sc6004_2170518
SL1_00sc6004_2170518_solcap_snp_sl_44911
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70592)
Chromosome
11
Position
86.09 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59832)
Chromosome
11
Position
52.36 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGCTAATCACAGAGATGAAGTCCTTCGAAGGGAGTGTCATGCCAGAAAAC
  
3' flanking region
ACAGTATGAGCAAGTTGCTTTGGACAACTATCGACACAGCAACATGAGCA
SNP nucleotide
AT
SNPdb format
AGCTAATCACAGAGATGAAGTCCTTCGAAGGGAGTGTCATGCCAGAAAAC[A/T]
ACAGTATGAGCAAGTTGCTTTGGACAACTATCGACACAGCAACATGAGCA
  
Genomic location of solcap_snp_sl_44911  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23501 marker 23501
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)