SGN Marker solcap_snp_sl_44933

SGN-M23505

Synonyms  
SL1_00sc6004_2258476
SL1_00sc6004_2258476_solcap_snp_sl_44933
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59836)
Chromosome
11
Position
52.44 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTGTTAGTTCAAGTAAATGGTTGCATAGACGATTTGCTGCGGCGGAGTGG
  
3' flanking region
AGGATTGAGAGAGGGATGAAGGAGGGGTTGGTGTTGGTTTACGACTGTGT
SNP nucleotide
TG
SNPdb format
GTGTTAGTTCAAGTAAATGGTTGCATAGACGATTTGCTGCGGCGGAGTGG[T/G]
AGGATTGAGAGAGGGATGAAGGAGGGGTTGGTGTTGGTTTACGACTGTGT
  
Genomic location of solcap_snp_sl_44933  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23505 marker 23505
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)