SGN Marker solcap_snp_sl_44937

SGN-M23507

Synonyms  
SL1_00sc6004_2266965
SL1_00sc6004_2266965_solcap_snp_sl_44937
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70597)
Chromosome
11
Position
87.46 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67082)
Chromosome
11
Position
92.36 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63549)
Chromosome
11
Position
104.77 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59838)
Chromosome
11
Position
52.45 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATATTGATCACGAGTGCCCCTTTAACTGGGGGCACATGAATCCAGCCATC
  
3' flanking region
CCTTTGGGCTCTCGCACGTAAAGGCCACCAACATCGTCTTGTAGTAGCAT
SNP nucleotide
AG
SNPdb format
ATATTGATCACGAGTGCCCCTTTAACTGGGGGCACATGAATCCAGCCATC[A/G]
CCTTTGGGCTCTCGCACGTAAAGGCCACCAACATCGTCTTGTAGTAGCAT
  
Genomic location of solcap_snp_sl_44937  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23507 marker 23507
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)