SGN Marker solcap_snp_sl_4523

SGN-M23547

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68961)
Chromosome
11
Position
50.31 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65327)
Chromosome
11
Position
47.97 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59878)
Chromosome
11
Position
8.76 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCAACTGCAACTTTAACAGCTGATTCAACTTCTTCTTCTTTCGAAACATC
  
3' flanking region
CATTGAATGTAACGACCTCCAATAGATTCAGCTAAACTTGTACCTACTTC
SNP nucleotide
AG
SNPdb format
TCAACTGCAACTTTAACAGCTGATTCAACTTCTTCTTCTTTCGAAACATC[A/G]
CATTGAATGTAACGACCTCCAATAGATTCAGCTAAACTTGTACCTACTTC
  
Genomic location of solcap_snp_sl_4523  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23547 marker 23547
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)