SGN Marker solcap_snp_sl_45416

SGN-M23574

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65336)
Chromosome
4
Position
54.04 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59905)
Chromosome
4
Position
48.86 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTTTGGAACATATAAACATGTTGTTACTCTGCCAAGGATAGAGTAAAATA
  
3' flanking region
TGGAGATATGCTCTCTTAAGATTCTGGATCAATTTTACCGTTGTCTTCCA
SNP nucleotide
AC
SNPdb format
GTTTGGAACATATAAACATGTTGTTACTCTGCCAAGGATAGAGTAAAATA[A/C]
TGGAGATATGCTCTCTTAAGATTCTGGATCAATTTTACCGTTGTCTTCCA
  
Genomic location of solcap_snp_sl_45416  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23574 marker 23574
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)