Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_45432

SGN-M23579

Synonyms  
CL015174-0292
CL015174-0292_solcap_snp_sl_45432
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59910)
Chromosome
4
Position
48.13 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCATATCGATCTGCATGTCTAAGCTTAAGCCTAATTGACGAATTCCCATA
  
3' flanking region
GATTTTGCAGTTGTGTGCCAGACACCGGTAACAGCATATCGACTCCCTGA
SNP nucleotide
TC
SNPdb format
TCATATCGATCTGCATGTCTAAGCTTAAGCCTAATTGACGAATTCCCATA[T/C]
GATTTTGCAGTTGTGTGCCAGACACCGGTAACAGCATATCGACTCCCTGA
  
Genomic location of solcap_snp_sl_45432  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23579 marker 23579
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)