SGN Marker solcap_snp_sl_45487

SGN-M23590

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73017)
Chromosome
4
Position
39.62 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68976)
Chromosome
4
Position
51.25 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59921)
Chromosome
4
Position
42.79 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGAAATTTCAGATGAACCATTCAGGGAAGACTCTATATCTATTGACAGTC
  
3' flanking region
ACGATTGAAGGATTTAAATAGTATTAACCAAAGGGCGTTCCTTATGTCCT
SNP nucleotide
AG
SNPdb format
AGAAATTTCAGATGAACCATTCAGGGAAGACTCTATATCTATTGACAGTC[A/G]
ACGATTGAAGGATTTAAATAGTATTAACCAAAGGGCGTTCCTTATGTCCT
  
Genomic location of solcap_snp_sl_45487  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23590 marker 23590
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)