SGN Marker solcap_snp_sl_45521

SGN-M23598

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73021)
Chromosome
4
Position
39.62 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65346)
Chromosome
4
Position
54.04 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59929)
Chromosome
4
Position
38.85 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GAACTGTTGAAACTGCTTCCTCTTAACAAATCTTTCCTTAACCGCAGGAT
  
3' flanking region
AATTTGAAACGAAGAGCCTCTGACCGCTCTTGAAAAATCAAAACTGCATT
SNP nucleotide
TC
SNPdb format
GAACTGTTGAAACTGCTTCCTCTTAACAAATCTTTCCTTAACCGCAGGAT[T/C]
AATTTGAAACGAAGAGCCTCTGACCGCTCTTGAAAAATCAAAACTGCATT
  
Genomic location of solcap_snp_sl_45521  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23598 marker 23598
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)