Notice: Due to a server issue, SGN was unavailable earlier today. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_45525

SGN-M23599

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65347)
Chromosome
4
Position
54.04 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59930)
Chromosome
4
Position
38.47 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TACACTCTATTTAGAGAAGCAAATTCAAGTGGTACTCCAGTTGCTCGTCC
  
3' flanking region
CTTTGGATGGAGTTCCCTGGAGACGAAAAATCCTTTAGCAATGATGAGGC
SNP nucleotide
TG
SNPdb format
TACACTCTATTTAGAGAAGCAAATTCAAGTGGTACTCCAGTTGCTCGTCC[T/G]
CTTTGGATGGAGTTCCCTGGAGACGAAAAATCCTTTAGCAATGATGAGGC
  
Genomic location of solcap_snp_sl_45525  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23599 marker 23599
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)