Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_45527

SGN-M23600

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73022)
Chromosome
4
Position
39.62 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65348)
Chromosome
4
Position
54.04 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59931)
Chromosome
4
Position
38.35 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGTTTTAATTGACTGAAGTTGAGCTAATCAGACAAAATGGGAGTTCCAGC
  
3' flanking region
TTTTATAGGTGGTTGGCTGATCGATACCCACTCTCAATTGTGGACATGGT
SNP nucleotide
AG
SNPdb format
AGTTTTAATTGACTGAAGTTGAGCTAATCAGACAAAATGGGAGTTCCAGC[A/G]
TTTTATAGGTGGTTGGCTGATCGATACCCACTCTCAATTGTGGACATGGT
  
Genomic location of solcap_snp_sl_45527  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23600 marker 23600
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)