SGN Marker solcap_snp_sl_46056

SGN-M23645

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68999)
Chromosome
10
Position
2.53 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65365)
Chromosome
10
Position
4.17 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59976)
Chromosome
10
Position
0.47 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTTCTGATGTTTCTCTTCCCACTTTTTCAATTAATATGTTTACTGTCGT
  
3' flanking region
GGAAGATATCTGAGGCACAGCAATGCAACTAAACCAAAATAATGTGAATT
SNP nucleotide
TC
SNPdb format
TTTTCTGATGTTTCTCTTCCCACTTTTTCAATTAATATGTTTACTGTCGT[T/C]
GGAAGATATCTGAGGCACAGCAATGCAACTAAACCAAAATAATGTGAATT
  
Genomic location of solcap_snp_sl_46056  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23645 marker 23645
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)