SGN Marker solcap_snp_sl_46340

SGN-M23654

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73058)
Chromosome
10
Position
6.61 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69004)
Chromosome
10
Position
9.77 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65370)
Chromosome
10
Position
21.31 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59985)
Chromosome
10
Position
1.40 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCCCGGACAAGGCTACCTACTTGAGCACCATCTGTGTATGCTTTACATGC
  
3' flanking region
ACAAGAATATCTTGTGCACTTCGAAAGAAATGCCCTAATACAAAATCTTC
SNP nucleotide
AC
SNPdb format
CCCCGGACAAGGCTACCTACTTGAGCACCATCTGTGTATGCTTTACATGC[A/C]
ACAAGAATATCTTGTGCACTTCGAAAGAAATGCCCTAATACAAAATCTTC
  
Genomic location of solcap_snp_sl_46340  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23654 marker 23654
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)