SGN Marker solcap_snp_sl_46475

SGN-M23662

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73063)
Chromosome
10
Position
15.70 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69006)
Chromosome
10
Position
22.52 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65372)
Chromosome
10
Position
32.24 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 59993)
Chromosome
10
Position
2.42 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCTTGCGAGGAATCCAACCATTAATAGCTTCACCGGCTACTGCAGCAAGC
  
3' flanking region
AAGAAGGCCATCCTGCAGCAATCAACTCTCCTTCCATTGCATTTGGGAAA
SNP nucleotide
AG
SNPdb format
CCTTGCGAGGAATCCAACCATTAATAGCTTCACCGGCTACTGCAGCAAGC[A/G]
AAGAAGGCCATCCTGCAGCAATCAACTCTCCTTCCATTGCATTTGGGAAA
  
Genomic location of solcap_snp_sl_46475  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23662 marker 23662
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)