SGN Marker solcap_snp_sl_47019

SGN-M23695

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73081)
Chromosome
4
Position
72.67 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69018)
Chromosome
4
Position
79.08 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65383)
Chromosome
4
Position
118.56 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60026)
Chromosome
4
Position
59.77 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TACTCTAATTAATCATCTTTGGTTGGAATTGTCTGTTATGTTTGTTCTTC
  
3' flanking region
GTACTAATTAATTAATATAATAAAATGCTATAATTATTAAATTTATCGTG
SNP nucleotide
AC
SNPdb format
TACTCTAATTAATCATCTTTGGTTGGAATTGTCTGTTATGTTTGTTCTTC[A/C]
GTACTAATTAATTAATATAATAAAATGCTATAATTATTAAATTTATCGTG
  
Genomic location of solcap_snp_sl_47019  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23695 marker 23695
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)