SGN Marker solcap_snp_sl_47050

SGN-M23698

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73083)
Chromosome
4
Position
73.49 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69020)
Chromosome
4
Position
80.66 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65385)
Chromosome
4
Position
118.56 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60029)
Chromosome
4
Position
60.07 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTGTCCTTAGCAATAACAGAGCTAACCACAGTTCCATACTTAGAAAAATG
  
3' flanking region
TCCTTTAGCATCTCATCACTCGTATCTCTCGGAATCCCACCACAAAAAAG
SNP nucleotide
AG
SNPdb format
CTGTCCTTAGCAATAACAGAGCTAACCACAGTTCCATACTTAGAAAAATG[A/G]
TCCTTTAGCATCTCATCACTCGTATCTCTCGGAATCCCACCACAAAAAAG
  
Genomic location of solcap_snp_sl_47050  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23698 marker 23698
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)