Notice: Due to a server issue, SGN was unavailable earlier today. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_47413

SGN-M23714

Synonyms  
CL016896-0356
CL016896-0356_solcap_snp_sl_47413
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60045)
Chromosome
4
Position
61.58 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCCCTATTGGGACTCCAATGAAAAGGGTGTTGGTTAATATGAAGGGTTAT
  
3' flanking region
TGGAAGAAGTTGGGCATTTGACTAAGCTTAACCCTCAAGATGCTTGGCTT
SNP nucleotide
TC
SNPdb format
GCCCTATTGGGACTCCAATGAAAAGGGTGTTGGTTAATATGAAGGGTTAT[T/C]
TGGAAGAAGTTGGGCATTTGACTAAGCTTAACCCTCAAGATGCTTGGCTT
  
Genomic location of solcap_snp_sl_47413  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23714 marker 23714
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)