Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_47487

SGN-M23717

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73092)
Chromosome
4
Position
83.67 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69026)
Chromosome
4
Position
94.85 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65391)
Chromosome
4
Position
134.28 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60048)
Chromosome
4
Position
61.95 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGTTTTAAGTTGATTGTCTCACAACAACTGTTCTTCAAGATAACTTTTGA
  
3' flanking region
ACTCCTCTCTGCTTTAGTGGAGTGAGGATGAAGCCTAACTAGGCTACGGA
SNP nucleotide
TG
SNPdb format
AGTTTTAAGTTGATTGTCTCACAACAACTGTTCTTCAAGATAACTTTTGA[T/G]
ACTCCTCTCTGCTTTAGTGGAGTGAGGATGAAGCCTAACTAGGCTACGGA
  
Genomic location of solcap_snp_sl_47487  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23717 marker 23717
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)