Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_47590

SGN-M23720

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73094)
Chromosome
4
Position
85.87 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69028)
Chromosome
4
Position
97.38 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65393)
Chromosome
4
Position
141.13 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60051)
Chromosome
4
Position
62.31 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGGGTGATCAGGAGACAAGTGTGGCTCCAAGTGTTGCTGATAAACAAAAT
  
3' flanking region
CGATGAGAACTATTTCTGAGCCTGATCACGATGGCAGTACTTGTTCAAGT
SNP nucleotide
TC
SNPdb format
AGGGTGATCAGGAGACAAGTGTGGCTCCAAGTGTTGCTGATAAACAAAAT[T/C]
CGATGAGAACTATTTCTGAGCCTGATCACGATGGCAGTACTTGTTCAAGT
  
Genomic location of solcap_snp_sl_47590  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23720 marker 23720
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)