Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_47660

SGN-M23724

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60055)
Chromosome
4
Position
62.69 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTCGATCCATCAGCCCTCGACCTCAACACACCCAATTCCTTCACAAACAC
  
3' flanking region
GCATAGTCATGTCCAGTCTCCTCCCAGTTAACACGTTTATCCGTAATCTC
SNP nucleotide
AT
SNPdb format
CTCGATCCATCAGCCCTCGACCTCAACACACCCAATTCCTTCACAAACAC[A/T]
GCATAGTCATGTCCAGTCTCCTCCCAGTTAACACGTTTATCCGTAATCTC
  
Genomic location of solcap_snp_sl_47660  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23724 marker 23724
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)