SGN Marker solcap_snp_sl_47749

SGN-M23742

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73110)
Chromosome
4
Position
90.55 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69038)
Chromosome
4
Position
105.91 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65403)
Chromosome
4
Position
150.05 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60073)
Chromosome
4
Position
63.26 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCGGATGAGCAGCTGGAATTCTGTGAACACACAGCAGGCTCATGTTCCTC
  
3' flanking region
GTGAGATTGCTCCTCTCCAACTGCTCAGGTTCATCTTCGAAACATTTGAA
SNP nucleotide
AG
SNPdb format
TCGGATGAGCAGCTGGAATTCTGTGAACACACAGCAGGCTCATGTTCCTC[A/G]
GTGAGATTGCTCCTCTCCAACTGCTCAGGTTCATCTTCGAAACATTTGAA
  
Genomic location of solcap_snp_sl_47749  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23742 marker 23742
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)