SGN Marker solcap_snp_sl_47762

SGN-M23744

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73111)
Chromosome
4
Position
90.55 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69039)
Chromosome
4
Position
106.23 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65404)
Chromosome
4
Position
152.07 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60075)
Chromosome
4
Position
63.30 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGGACTTCCAAACCAACTGGTGCCTTTATACTTGCTGTGTATGTTGCGTC
  
3' flanking region
TCTTGTCCTACGTTAGTTACAGTTCTTGTTACTTTCTTGATTTCATTTTC
SNP nucleotide
TG
SNPdb format
TGGACTTCCAAACCAACTGGTGCCTTTATACTTGCTGTGTATGTTGCGTC[T/G]
TCTTGTCCTACGTTAGTTACAGTTCTTGTTACTTTCTTGATTTCATTTTC
  
Genomic location of solcap_snp_sl_47762  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23744 marker 23744
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)