SGN Marker solcap_snp_sl_4963

SGN-M23929

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69111)
Chromosome
1
Position
43.20 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65470)
Chromosome
1
Position
59.88 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60260)
Chromosome
1
Position
69.69 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTAGAGTTATGTTGGTGGAAGGAAGTACAGAGAAGAAGCATAGAGATGTT
  
3' flanking region
GAGAATTGGGTGGGAGATTGTTTTTTCCAGAGCTCCAACTATATGATATA
SNP nucleotide
TC
SNPdb format
GTAGAGTTATGTTGGTGGAAGGAAGTACAGAGAAGAAGCATAGAGATGTT[T/C]
GAGAATTGGGTGGGAGATTGTTTTTTCCAGAGCTCCAACTATATGATATA
  
Genomic location of solcap_snp_sl_4963  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D23929 marker 23929
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)